Review

tet2 (New England Biolabs)

New England Biolabs is a verified supplier

New England Biolabs manufactures this product

About

News

Press Release

Team

Advisors

Partners

Contact

Bioz Stars

Bioz vStars

Buy from Supplier

Structured Review

New England Biolabs tet2
Tet2, supplied by New England Biolabs, used in various techniques. Bioz Stars score: 95/100, based on 72 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/product/tet2/TET2/pmc13693690-194-6-14
Average 95 stars, based on 72 article reviews

tet2 - by Bioz Stars, 2026-11

95/100 stars

Images

other:

Article Title: Tet2 deficiency orchestrates Alzheimer's pathogenesis through oxidative mtDNA-driven cGAS-STING activation.
Article Snippet: Briefly, 100 ng DNA per sample was spiked with unmethylated λDNA, sheared to ~200-350 bp, and processed with the NEB Next® enzymatic methyl‐seq kit (E7120L) after sequential Tet2 and APOBEC3A treatment.

Article Title: Spatial 5mC-seq profiling of embryos and decidua after implantation in mammals.
Article Snippet: DNA methylation is vital for development and diseases, yet no spatial DNA methylation profiling technology has been reported.. Here we developed spatial 5mC-seq (SmC-seq), a microfluidic-based method providing unbiased genome-wide methylome at near single-cell resolution.. Applying SmC-seq to mouse post-implantation development revealed a clear spatial heterogenous pattern of DNA methylation in inner cell mass-derived tissues.

Article Title: Structural basis for L-isoaspartyl-containing protein recognition by the human PCMTD1 cullin-RING E3 ubiquitin ligase
Article Snippet: CUL5 1-384 (pET24+) was obtained from Twist Bioscience.

Article Title: Spatial 5mC-seq profiling of embryos and decidua after implantation in mammal
Article Snippet: To distinguish the 5mCs in the extended DNA fragments from other cytosines, the 5mCs were oxidized by TET2, and the resulting 5hmCs or 5caC, along with the 5hmCs incorporated into the adapters and barcodes during the extension step, were glucosylated in a one-step reaction using T4 Phage β-glucosyltransferase (NEB), following the manufacturer’s instructions.

DNA Extraction:

Article Title: Maintenance DNA methylation is required for induced Treg reparative function following viral pneumonia in mice
Article Snippet: .. Briefly, after genomic DNA extraction using the QIAGEN AllPrep DNA/RNA Micro Kit (catalog 80204), 0.5–1 ng of genomic DNA was digested using restriction endonuclease MspI (New England Biolabs) and then enzymatically converted with TET2 and APOBEC (New England Biolabs) per the manufacturer’s instructions. .. Random priming, adapter ligation, PCR product clean-up, and final library amplification were performed using the Pico Methyl-Seq Library Prep Kit (Zymo Research).

Gentle:

Article Title: From concept to clinic: a roadmap for DNA methylation biomarkers in liquid biopsies
Article Snippet: .. Recently, enzymatic conversion using TET2 and APOBEC enzymes (EM-seq; New England BioLabs) has been presented as more gentle and promising alternative to bisulfite conversion [ ]. ..

Article Title: From concept to clinic: a roadmap for DNA methylation biomarkers in liquid biopsies.
Article Snippet: .. Recently, enzymatic conversion using TET2 and APOBEC enzymes (EM-seq; New England BioLabs) has been presented as more gentle and promising alternative to bisulfite conversion [58]. ..

Purification:

Article Title: High-throughput droplet-based enzymatic DNA methylome profiling enables single-cell resolution of epigenetic heterogeneity
Article Snippet: The product was then purified with 1.2× VAHTS DNA clean beads (N411-03, Vazyme Biotech, China). .. The purified DNA was oxidated with TET2 and subsequently deaminated with APOBEC using the NEBNext Enzymatic Methyl-seq Kit (E7120S, New England Biolabs, USA) according to the manufacturer’s instructions. .. After C to U transition, the DNA was amplified by PCR mixture containing 0.5 μl of EpiTaq HS (R110A, Takara, Japan), 5 μl of 10 ×EpiTaq PCR buffer, 6 μl of deoxynucleoside triphosphate mixture (2.5 mM each), 5 μl of 25 mM MgCl 2 , 1 μl of 100 μM primer (5′CTACACGACGCTCTTCCGATCT3′) with the following program: step 1: 98°C 1 min; step 2: 98°C 10 s, 57°C 30 s, and 72°C 3 min and repeat step 2 an additional 8 to 10 times according to the input cells; step 3: 72°C 5 min and hold at 4°C.

Image Search Results

(A and B) Naïve IgM + IgD + B cells from C57BL/6 mouse spleen ( n = 3) were cultured for 0, 24, 48, 72, or 96 h upon stimulation with E. coli 055:B5 LPS plus IL-4. (A) Left, cell Tet1, Tet2, Tet3, Aicda , and Prdm1 expression at the indicated time points. Right, intracellular TET2 expression in mouse naïve B cells, GC-like B cells, and plasma cells after 96 h culture. (B) Left, cell TET1, TET2, phosphorylated TET2 ( p -TET2), acetylated TET2 (Ac-TET2), TET3, AID, BLIMP-1, and β-ACTIN protein expression at indicated time points, as analyzed by specific immunoblots. Right, densitometry quantification of such immunoblotted signals is normalized to β-ACTIN levels. (C) Naïve huIgM + IgD + B cells from healthy humans ( n = 3) were cultured for 96 h upon stimulation with CD154, huIL-2, huIL-4, and huIL-21. Intracellular TET2 expression in human naïve B cells, GC-like B cells, and plasma cells. In truncated violin plots (A and C), each dot represents cell TET2 mean fluorescent intensity (MFI) from one in vitro B cell microculture. Top and bottom edges of each plot indicate the maximum and minimum MFI values, respectively; the line indicates the median. (D) Top, cell surface marker and intracellular TET2 expression profiles (heatmaps) of spleen and MLNs mononuclear cells in NP-CGG-immunized C57BL/6 mice ( n = 3) were integrated to create t-SNE maps and analyze intracellular TET2 expression in mouse naïve B cells, GC B cells, late GC B cells, plasmablasts, plasma cells, and swMBCs. Bottom, cell surface marker and intracellular TET2 expression profiles (heatmap) of human tonsil ( n = 3) mononuclear cells were merged to create t-SNE maps and analyze intracellular TET2 expression in human transitional B cells, naïve B cells, early GC B cells, GC B cells, double-negative (DN) B cells, plasma cells, and swMBCs. Statistical significance (A and C) was assessed using two-sided Student’s unpaired t test (* p < 0.05, ** p < 0.01, *** p < 0.001).

Journal: Cell reports

Article Title: B cell TET2 recruits OGT for nuclear TET2 and H2B O -GlcNAcylation to drive AID and BLIMP-1 expression and maturation of the antibody response

doi: 10.1016/j.celrep.2026.117370

Figure Lengend Snippet: (A and B) Naïve IgM + IgD + B cells from C57BL/6 mouse spleen ( n = 3) were cultured for 0, 24, 48, 72, or 96 h upon stimulation with E. coli 055:B5 LPS plus IL-4. (A) Left, cell Tet1, Tet2, Tet3, Aicda , and Prdm1 expression at the indicated time points. Right, intracellular TET2 expression in mouse naïve B cells, GC-like B cells, and plasma cells after 96 h culture. (B) Left, cell TET1, TET2, phosphorylated TET2 ( p -TET2), acetylated TET2 (Ac-TET2), TET3, AID, BLIMP-1, and β-ACTIN protein expression at indicated time points, as analyzed by specific immunoblots. Right, densitometry quantification of such immunoblotted signals is normalized to β-ACTIN levels. (C) Naïve huIgM + IgD + B cells from healthy humans ( n = 3) were cultured for 96 h upon stimulation with CD154, huIL-2, huIL-4, and huIL-21. Intracellular TET2 expression in human naïve B cells, GC-like B cells, and plasma cells. In truncated violin plots (A and C), each dot represents cell TET2 mean fluorescent intensity (MFI) from one in vitro B cell microculture. Top and bottom edges of each plot indicate the maximum and minimum MFI values, respectively; the line indicates the median. (D) Top, cell surface marker and intracellular TET2 expression profiles (heatmaps) of spleen and MLNs mononuclear cells in NP-CGG-immunized C57BL/6 mice ( n = 3) were integrated to create t-SNE maps and analyze intracellular TET2 expression in mouse naïve B cells, GC B cells, late GC B cells, plasmablasts, plasma cells, and swMBCs. Bottom, cell surface marker and intracellular TET2 expression profiles (heatmap) of human tonsil ( n = 3) mononuclear cells were merged to create t-SNE maps and analyze intracellular TET2 expression in human transitional B cells, naïve B cells, early GC B cells, GC B cells, double-negative (DN) B cells, plasma cells, and swMBCs. Statistical significance (A and C) was assessed using two-sided Student’s unpaired t test (* p < 0.05, ** p < 0.01, *** p < 0.001).

Article Snippet: anti-mo/hu-TET2 Ab , ABclonal , Cat. # A20365.

Techniques: Cell Culture, Expressing, Clinical Proteomics, Western Blot, In Vitro, Marker

Aicda Cre Tet2 +/+ ( n = 5) and Aicda Cre Tet2 fl/fl ( n = 5) mice were injected intraperitoneally (i.p.) with NP 16 -CGG on day 0, boosted on day 14, and euthanized on day 28. (A) Left, serum NP 4 -specific IgM, IgG1, and IgA, as measured by ELISAs (titers expressed as relative units, RUs). In floating bar plots, each dot represents one mouse. The top and bottom edges indicate the full range of the data. Right, NP 4 -specific IgM, IgG1, and IgA ASCs in spleen and BM, as analyzed and enumerated by specific ELISPOTs. (B) IgM + , IgD + , and IgA + cells in Peyer’s patches (Scale bars: 100 μm). (C) GC B220 + GL7 + CD95 + IgG1 + B cells, B220 + IgG1 + B cells, B220 + CD138 + plasmablasts, NP 5 -specific GC B220 + IgM – IgD – IgG1 + B cells and NP 5 -specific CD38 + IgG1 + swMBCs among mononuclear cells in spleen. (D) B cell Tet2, Aicda, Prdm1, Irf4 , and Bach2 transcript expression in spleen, as analyzed by qRT-PCR. (E) Transduced Tet2 +/+ and Tet2 −/− B cells were cultured for 96 h upon stimulation with LPS plus IL-4. Left, CD19 + IgG1 + B cells and CD19 + CD138 + plasmablasts among pre-gated Tet2 −/− GFP + cells transduced by pMIG-Empty , pMIG-Aicda , or pMIG-Prdm1 retroviral vector (left, n = 3) or among Tet2 +/+ GFP + cells transduced by pMIG-Empty or pMIG-Tet2 retroviral vectors (right, n = 3). (F) Somatic point-mutations in IgG1 + B cell V1-72DJ H -Cγ1 transcripts of NP-CGG-immunized mice. Pie charts: slices depict proportions of V1-72DJ H -Cγ1 transcripts carrying different numbers of point-mutations; slice gray gradients depict increasing numbers of point-mutations (from 0 to more than 12 per transcript); the overall mutation frequency is listed below each pie chart ( Aicda Cre Tet2 +/+ : 2.51 × 10 −2 change/base vs. Aicda Cre Tet2 fl/fl : 0.42 × 10 −2 change/base). Histograms depict means of total, S, and R V1-72 mutation frequencies (change/base) in FR1, CDR1, FR2, CDR2, and FR3 of V1-72DJ H -Cγ1 transcripts. Boxplots depict overall V1-72 point-mutation in V1-72DJ H -Cγ1 transcripts. In boxplots, data points are displayed as individual dots, each dot representing a single sequence. Box includes the 2 nd and 3 rd quartiles (top 75% to bottom 25%) of data, line indicates median, and cross indicates the geometrical mean of data, whiskers show the spread of data (95%–5%), and dots above and below whiskers are outliers. (G and H) Naïve IgM + IgD + B cells from Aicda Cre Tet2 +/+ ( n = 3) and Aicda Cre Tet2 fl/fl ( n = 3) mice spleen were cultured for 72 h upon stimulation with LPS plus IL-4. (G) Intracellular AID and BLIMP-1 expression were analyzed by flow cytometry. (H) AID, BLIMP-1, and β-ACTIN protein expression as analyzed by specific immunoblots. Statistical significance (A, C, E, and G) was assessed using two-sided Student’s unpaired t test (ns, not significant; ** p < 0.01, *** p < 0.001).

Journal: Cell reports

Article Title: B cell TET2 recruits OGT for nuclear TET2 and H2B O -GlcNAcylation to drive AID and BLIMP-1 expression and maturation of the antibody response

doi: 10.1016/j.celrep.2026.117370

Figure Lengend Snippet: Aicda Cre Tet2 +/+ ( n = 5) and Aicda Cre Tet2 fl/fl ( n = 5) mice were injected intraperitoneally (i.p.) with NP 16 -CGG on day 0, boosted on day 14, and euthanized on day 28. (A) Left, serum NP 4 -specific IgM, IgG1, and IgA, as measured by ELISAs (titers expressed as relative units, RUs). In floating bar plots, each dot represents one mouse. The top and bottom edges indicate the full range of the data. Right, NP 4 -specific IgM, IgG1, and IgA ASCs in spleen and BM, as analyzed and enumerated by specific ELISPOTs. (B) IgM + , IgD + , and IgA + cells in Peyer’s patches (Scale bars: 100 μm). (C) GC B220 + GL7 + CD95 + IgG1 + B cells, B220 + IgG1 + B cells, B220 + CD138 + plasmablasts, NP 5 -specific GC B220 + IgM – IgD – IgG1 + B cells and NP 5 -specific CD38 + IgG1 + swMBCs among mononuclear cells in spleen. (D) B cell Tet2, Aicda, Prdm1, Irf4 , and Bach2 transcript expression in spleen, as analyzed by qRT-PCR. (E) Transduced Tet2 +/+ and Tet2 −/− B cells were cultured for 96 h upon stimulation with LPS plus IL-4. Left, CD19 + IgG1 + B cells and CD19 + CD138 + plasmablasts among pre-gated Tet2 −/− GFP + cells transduced by pMIG-Empty , pMIG-Aicda , or pMIG-Prdm1 retroviral vector (left, n = 3) or among Tet2 +/+ GFP + cells transduced by pMIG-Empty or pMIG-Tet2 retroviral vectors (right, n = 3). (F) Somatic point-mutations in IgG1 + B cell V1-72DJ H -Cγ1 transcripts of NP-CGG-immunized mice. Pie charts: slices depict proportions of V1-72DJ H -Cγ1 transcripts carrying different numbers of point-mutations; slice gray gradients depict increasing numbers of point-mutations (from 0 to more than 12 per transcript); the overall mutation frequency is listed below each pie chart ( Aicda Cre Tet2 +/+ : 2.51 × 10 −2 change/base vs. Aicda Cre Tet2 fl/fl : 0.42 × 10 −2 change/base). Histograms depict means of total, S, and R V1-72 mutation frequencies (change/base) in FR1, CDR1, FR2, CDR2, and FR3 of V1-72DJ H -Cγ1 transcripts. Boxplots depict overall V1-72 point-mutation in V1-72DJ H -Cγ1 transcripts. In boxplots, data points are displayed as individual dots, each dot representing a single sequence. Box includes the 2 nd and 3 rd quartiles (top 75% to bottom 25%) of data, line indicates median, and cross indicates the geometrical mean of data, whiskers show the spread of data (95%–5%), and dots above and below whiskers are outliers. (G and H) Naïve IgM + IgD + B cells from Aicda Cre Tet2 +/+ ( n = 3) and Aicda Cre Tet2 fl/fl ( n = 3) mice spleen were cultured for 72 h upon stimulation with LPS plus IL-4. (G) Intracellular AID and BLIMP-1 expression were analyzed by flow cytometry. (H) AID, BLIMP-1, and β-ACTIN protein expression as analyzed by specific immunoblots. Statistical significance (A, C, E, and G) was assessed using two-sided Student’s unpaired t test (ns, not significant; ** p < 0.01, *** p < 0.001).

Article Snippet: anti-mo/hu-TET2 Ab , ABclonal , Cat. # A20365.

Techniques: Injection, Expressing, Quantitative RT-PCR, Cell Culture, Retroviral, Plasmid Preparation, Mutagenesis, Sequencing, Flow Cytometry, Western Blot

Naïve IgM + IgD + B cells from Aicda Cre Ogt +/+ and Aidca Cre Ogt fl/fl mice spleen ( n = 3, A–C) or Aicda Cre Tet2 +/+ and Aidca Cre Tet2 fl/fl mice spleen ( n = 3, B and G) were cultured for 72 h or 96 h upon application of GC-like cell-inducing stimuli. (A) Left, CD19 + IgG1 + , CD19 + IgG3 + or CD19 + IgA + B cells and CD19 + CD138 + plasmablasts. Right, intracellular AID and BLIMP-1 expression in B cells stimulated with LPS plus IL-4 after 96 h microculture. (B) Methylated and hydroxymethylated DNA levels in promoter and enhancer regions of Aicda and Prdm1 gene loci in Aicda Cre Tet2 +/+ , Aicda Cre Tet2 fl/fl (top), Aicda Cre Ogt +/+ , and Aicda Cre Ogt fl/fl (bottom) cells after 72 h microculture, as analyzed by MeDIP-qPCR and hMeDIP-qPCR. (C) Expression of TET2 and O -GlcNAcylated TET2 in Aidca Cre Ogt +/+ and Aidca Cre Ogt fl/fl cells after 96 h microculture. (D) Naïve IgM + IgD + B cells from C57BL/6 ( n = 3) mice spleen or healthy humans ( n = 3) were cultured for 0, 24, 48, 72, and 96 h upon stimulation with LPS plus IL-4 or CpG (ODN 2395) plus huIL-2, huIL-4, and huIL-21, respectively. Expression of TET2 and O -GlcNAcylated TET2 in mouse and human B cells at the indicated time points. (E) TET2 O -GlcNAcylation sites in mouse B cells, as predicted by YinOYang and O -GlcNAcPRED-DL. (F) Naïve IgM + IgD + B cells from C57BL/6 mice ( n = 3) spleen were cultured for 72 h upon stimulation with LPS plus IL-4. TET2 or OGT interaction with TET2, OGT, PROSER1, HDAC1, and CREBBP in cell nuclei, as analyzed by specific immunoblots. (G) Aidca Cre Tet2 +/+ and Aidca Cre Tet2 fl/fl B cell OGT (left) and O -GlcNAc H2B-S112 (right) levels after 72 h microculture, as expressed in promoter and enhancer regions of Aicda and Prdm1 gene loci, as analyzed by ChIP-qPCR. Statistical significance (B and G) was assessed using two-sided Student’s unpaired t test (** p < 0.01, *** p < 0.001).

Journal: Cell reports

Article Title: B cell TET2 recruits OGT for nuclear TET2 and H2B O -GlcNAcylation to drive AID and BLIMP-1 expression and maturation of the antibody response

doi: 10.1016/j.celrep.2026.117370

Figure Lengend Snippet: Naïve IgM + IgD + B cells from Aicda Cre Ogt +/+ and Aidca Cre Ogt fl/fl mice spleen ( n = 3, A–C) or Aicda Cre Tet2 +/+ and Aidca Cre Tet2 fl/fl mice spleen ( n = 3, B and G) were cultured for 72 h or 96 h upon application of GC-like cell-inducing stimuli. (A) Left, CD19 + IgG1 + , CD19 + IgG3 + or CD19 + IgA + B cells and CD19 + CD138 + plasmablasts. Right, intracellular AID and BLIMP-1 expression in B cells stimulated with LPS plus IL-4 after 96 h microculture. (B) Methylated and hydroxymethylated DNA levels in promoter and enhancer regions of Aicda and Prdm1 gene loci in Aicda Cre Tet2 +/+ , Aicda Cre Tet2 fl/fl (top), Aicda Cre Ogt +/+ , and Aicda Cre Ogt fl/fl (bottom) cells after 72 h microculture, as analyzed by MeDIP-qPCR and hMeDIP-qPCR. (C) Expression of TET2 and O -GlcNAcylated TET2 in Aidca Cre Ogt +/+ and Aidca Cre Ogt fl/fl cells after 96 h microculture. (D) Naïve IgM + IgD + B cells from C57BL/6 ( n = 3) mice spleen or healthy humans ( n = 3) were cultured for 0, 24, 48, 72, and 96 h upon stimulation with LPS plus IL-4 or CpG (ODN 2395) plus huIL-2, huIL-4, and huIL-21, respectively. Expression of TET2 and O -GlcNAcylated TET2 in mouse and human B cells at the indicated time points. (E) TET2 O -GlcNAcylation sites in mouse B cells, as predicted by YinOYang and O -GlcNAcPRED-DL. (F) Naïve IgM + IgD + B cells from C57BL/6 mice ( n = 3) spleen were cultured for 72 h upon stimulation with LPS plus IL-4. TET2 or OGT interaction with TET2, OGT, PROSER1, HDAC1, and CREBBP in cell nuclei, as analyzed by specific immunoblots. (G) Aidca Cre Tet2 +/+ and Aidca Cre Tet2 fl/fl B cell OGT (left) and O -GlcNAc H2B-S112 (right) levels after 72 h microculture, as expressed in promoter and enhancer regions of Aicda and Prdm1 gene loci, as analyzed by ChIP-qPCR. Statistical significance (B and G) was assessed using two-sided Student’s unpaired t test (** p < 0.01, *** p < 0.001).

Article Snippet: anti-mo/hu-TET2 Ab , ABclonal , Cat. # A20365.

Techniques: Cell Culture, Expressing, Methylation, Methylated DNA Immunoprecipitation, Western Blot, ChIP-qPCR

(A) TET2 isoform 2 (green)-DNA (gray)-OGT (yellow) complex assembly at Aicda Area IV (top, iPTM = 0.65) and Prdm1 Area II (bottom, iPTM = 0.66), as predicted by AlphaFold 3.0; depicted are TET2 conserved signature HxD catalytic motif (purple) and TET2 C-terminal-end OGT-binding site (dark blue). (B) Schematic of pMIG-Tet2 WT , pMIG-Tet2 HxD-mut , pMIG-Tet2 OGT -Δ mut , and pMIG-Tet2 HxD-mut/OGT -Δ mut constructs. (C) Tet2 −/− B cells ( n = 3) were transduced to induce expression of pMIG-Empty vector , pMIG-Tet2 WT , pMIG-Tet2 HxD-mut , pMIG-Tet2 OGT -Δ mut , or pMIG-Tet2 HxD-mut/OGT -Δ mut and cultured for 96 h upon stimulation with LPS plus IL-4. TET2 expression in these B cells, as analyzed by specific immunoblots. CD19 + IgG1 + B cells, CD19 + CD138 + plasmablasts, and intracellular TET2 expression among transduced GFP + Tet2 −/− cells (pre-gated). Statistical significance was assessed using two-sided Student’s unpaired t test (ns, not significant; *** p < 0.001).

Journal: Cell reports

Article Title: B cell TET2 recruits OGT for nuclear TET2 and H2B O -GlcNAcylation to drive AID and BLIMP-1 expression and maturation of the antibody response

doi: 10.1016/j.celrep.2026.117370

Figure Lengend Snippet: (A) TET2 isoform 2 (green)-DNA (gray)-OGT (yellow) complex assembly at Aicda Area IV (top, iPTM = 0.65) and Prdm1 Area II (bottom, iPTM = 0.66), as predicted by AlphaFold 3.0; depicted are TET2 conserved signature HxD catalytic motif (purple) and TET2 C-terminal-end OGT-binding site (dark blue). (B) Schematic of pMIG-Tet2 WT , pMIG-Tet2 HxD-mut , pMIG-Tet2 OGT -Δ mut , and pMIG-Tet2 HxD-mut/OGT -Δ mut constructs. (C) Tet2 −/− B cells ( n = 3) were transduced to induce expression of pMIG-Empty vector , pMIG-Tet2 WT , pMIG-Tet2 HxD-mut , pMIG-Tet2 OGT -Δ mut , or pMIG-Tet2 HxD-mut/OGT -Δ mut and cultured for 96 h upon stimulation with LPS plus IL-4. TET2 expression in these B cells, as analyzed by specific immunoblots. CD19 + IgG1 + B cells, CD19 + CD138 + plasmablasts, and intracellular TET2 expression among transduced GFP + Tet2 −/− cells (pre-gated). Statistical significance was assessed using two-sided Student’s unpaired t test (ns, not significant; *** p < 0.001).

Article Snippet: anti-mo/hu-TET2 Ab , ABclonal , Cat. # A20365.

Techniques: Binding Assay, Construct, Expressing, Plasmid Preparation, Cell Culture, Western Blot

Humanized THX mice were fed nil ( n = 5) or dimethyl fumarate (DMF, 0.5 mg/mL, n = 5) on day 0 and continued thereafter. (A-E) Nil-fed and DMF-fed THX mice were injected i.p. with NP 16 -CGG on day 7, boosted on days 14, 21, and 28, and euthanized on day 35. (A) Left, schematic of NP 16 -CGG immunization. Right, serum NP 4 -specific huIgM, huIgG1, and huIgA, as measured by ELISAs (titers expressed as RUs). (B) Intracellular TET2, AID, and BLIMP-1 expression among pre-gated huCD45 + CD19 + B cells in spleen. (C) Left, class-switched memory huCD27 + CD38 − B cells and huCD27 + CD38 + plasmablasts among pre-gated huCD19 + IgG + or huCD19 + IgA + cells in spleen. Right, NP 5 -specific huIgG + and huIgA + B cells among pre-gated huCD45 + CD19 + cells in spleen. (D) Left, memory huCD27 + CD38 − B cells and huCD27 + CD38 + plasmablasts among pre-gated huCD19 + B cells in spleen and BM. Right, huIgG + and huIgA + B cells among pre-gated huCD45 + CD19 + cells in spleen and BM. (E) Somatic point-mutations in huIgG1 + B cell huV3DJ H -Cγ1 transcripts of NP-CGG-immunized THX mice. Left, pie charts depict proportions of huV3DJ H -Cγ1 transcripts carrying different numbers of point-mutations; the overall mutation frequency is listed below each pie chart (Nil-fed THX mice: 2.2 × 10 −2 change/base vs. DMF-fed THX mice: 0.9 × 10 −2 change/base). Center, histograms depict means of total, S, and R huV3 mutation frequencies (change/base) in FR1, CDR1, FR2, CDR2, and FR3 of huV3DJH-Cγ1. Boxplots depict overall V1-72 point-mutation frequency in huV3DJ H -Cγ1 transcripts. Right, huV3DJ H -Cγ1 B cell clones and intraclonal diversification, as depicted by TreeMaps and phylogenetic trees, respectively. An individual rectangle or square (unique color) Area reflects the human B cell clone size. (F) Naïve huIgM + IgD + B cells from healthy humans ( n = 3) were cultured for 72 h or 96 h upon stimulation with CpG plus huIL-2, huIL-4, and huIL-21 in the presence of nil or vitamin C (200 μM). Left, huIgG + B cells, huIgA + B cells, and huCD27 + CD38 + plasmablasts among pre-gated huCD19 + cells after 96 h culture. Center, cell AICDA and PRDM1 expression after 72 h of culture. Right, methylated and hydroxymethylated DNA in promoter and enhancer regions of AICDA and PRDM1 gene loci after 72 h culture in human B cells. Statistical significance (A and C–F) was assessed using two-sided Student’s unpaired t test (ns, not significant; * p < 0.05, ** p < 0.01, *** p < 0.001).

Journal: Cell reports

Article Title: B cell TET2 recruits OGT for nuclear TET2 and H2B O -GlcNAcylation to drive AID and BLIMP-1 expression and maturation of the antibody response

doi: 10.1016/j.celrep.2026.117370

Figure Lengend Snippet: Humanized THX mice were fed nil ( n = 5) or dimethyl fumarate (DMF, 0.5 mg/mL, n = 5) on day 0 and continued thereafter. (A-E) Nil-fed and DMF-fed THX mice were injected i.p. with NP 16 -CGG on day 7, boosted on days 14, 21, and 28, and euthanized on day 35. (A) Left, schematic of NP 16 -CGG immunization. Right, serum NP 4 -specific huIgM, huIgG1, and huIgA, as measured by ELISAs (titers expressed as RUs). (B) Intracellular TET2, AID, and BLIMP-1 expression among pre-gated huCD45 + CD19 + B cells in spleen. (C) Left, class-switched memory huCD27 + CD38 − B cells and huCD27 + CD38 + plasmablasts among pre-gated huCD19 + IgG + or huCD19 + IgA + cells in spleen. Right, NP 5 -specific huIgG + and huIgA + B cells among pre-gated huCD45 + CD19 + cells in spleen. (D) Left, memory huCD27 + CD38 − B cells and huCD27 + CD38 + plasmablasts among pre-gated huCD19 + B cells in spleen and BM. Right, huIgG + and huIgA + B cells among pre-gated huCD45 + CD19 + cells in spleen and BM. (E) Somatic point-mutations in huIgG1 + B cell huV3DJ H -Cγ1 transcripts of NP-CGG-immunized THX mice. Left, pie charts depict proportions of huV3DJ H -Cγ1 transcripts carrying different numbers of point-mutations; the overall mutation frequency is listed below each pie chart (Nil-fed THX mice: 2.2 × 10 −2 change/base vs. DMF-fed THX mice: 0.9 × 10 −2 change/base). Center, histograms depict means of total, S, and R huV3 mutation frequencies (change/base) in FR1, CDR1, FR2, CDR2, and FR3 of huV3DJH-Cγ1. Boxplots depict overall V1-72 point-mutation frequency in huV3DJ H -Cγ1 transcripts. Right, huV3DJ H -Cγ1 B cell clones and intraclonal diversification, as depicted by TreeMaps and phylogenetic trees, respectively. An individual rectangle or square (unique color) Area reflects the human B cell clone size. (F) Naïve huIgM + IgD + B cells from healthy humans ( n = 3) were cultured for 72 h or 96 h upon stimulation with CpG plus huIL-2, huIL-4, and huIL-21 in the presence of nil or vitamin C (200 μM). Left, huIgG + B cells, huIgA + B cells, and huCD27 + CD38 + plasmablasts among pre-gated huCD19 + cells after 96 h culture. Center, cell AICDA and PRDM1 expression after 72 h of culture. Right, methylated and hydroxymethylated DNA in promoter and enhancer regions of AICDA and PRDM1 gene loci after 72 h culture in human B cells. Statistical significance (A and C–F) was assessed using two-sided Student’s unpaired t test (ns, not significant; * p < 0.05, ** p < 0.01, *** p < 0.001).

Article Snippet: anti-mo/hu-TET2 Ab , ABclonal , Cat. # A20365.

Techniques: Injection, Expressing, Mutagenesis, Clone Assay, Cell Culture, Methylation

(A-D) Tcrβ −/− Tcrδ −/− mice were injected i.p. with nil (PBS, n = 7) or vitamin C (Vit C, 80 mg per mice, n = 7) on days 1, 1, 3, and 5. Nil-treated and vitamin C-treated Tcrβ −/− Tcrδ −/− mice were immunized i.p. with NP 0.4 -LPS on day 0, boosted on days 14 and 23, and euthanized on day 44. (A) Top left, schematic of nil or vitamin C administration and NP 0.4 -LPS immunization. Top center, sera were collected on days 7, 14, 23, 33, and 44 and analyzed for NP 4 - or LPS-specific IgM, IgG3, and IgG2b, as measured by ELISAs (titers expressed as RUs). Truncated violin plots depict NP 4 - or LPS-specific IgM, IgG3, and IgG2b titers through day 44. Top right, floating bar plots depict NP 4 - or LPS-specific antibody titers at day 33. Bottom right, GC GL7 + CD95 + B cells, class-switched GC GL7 + CD95 + IgG3 + and GL7 + CD95 + IgG2b + B cells among pre-gated CD19 + cells in MLNs (left), NP 5 -specific IgG3 + and IgG2b + B cells among pre-gated CD19 + cells in spleen (center), and CD19 + CD138 + plasmablasts among mononuclear cells in MLNs (right). (B) NP 4 -specific IgM, IgG3, and IgG2b ASCs in spleen and BM, as analyzed and enumerated by specific ELISPOTs. (C) Somatic point-mutations in IgG3 + B cell V1-72DJ H -Cγ3 and IgG2b + B cell V1-72DJ H -Cγ2b transcripts. Left, pie charts depict proportions of V1-72DJ H -Cγ3 and V1-72DJ H -Cγ2b transcripts carrying different numbers of point-mutations; the overall mutation frequency is listed below each pie chart (V1-72DJ H -Cγ3: nil, 0.65 × 10 −2 change/base vs. vitamin C, 2.19 × 10 −2 change/base; V1-72DJ H -Cγ2b: nil, 0.71 × 10 −2 change/base vs. vitamin C, 1.35 × 10 −2 change/base). Center, histograms depict means of total, S, and R V1-72 mutation frequencies (change/base) in FR1, CDR1, FR2, CDR2, and FR3 of V1-72DJ H -Cγ3 and V1-72DJ H -Cγ2b transcripts. Right, boxplots depict overall V1-72 point-mutation frequency in V1-72DJ H -Cγ3 and V1-72DJ H -Cγ2b transcripts. (D) Intracellular TET2, AID, and BLIMP-1 expression among pre-gated CD19 + cells in spleen. (E) Naïve IgM + IgD + B cells from C57BL/6 mice ( n = 3) were cultured for 72 h or 96 h upon stimulation with LPS plus IL-4 in the presence of nil or vitamin C (200 μM). Left, flow cytometry plots from one in vitro B cell microculture representative of 3 cell microcultures. CD19 + IgG1 + B cells and CD19 + CD138 + plasmablasts after 96 h culture. Top right, recruited TET2 and O -GlcNAcylation H2B-S112 levels in Aicda and Prdm1 promoter and enhancer regions in mouse B cells after 72 h culture. Bottom right, cell methylated and hydroxymethylated DNA in Aicda and Prdm1 promoter and enhancer regions after 72 h culture. Statistical significance (A, C, and E) was assessed using two-sided Student’s unpaired t test (ns, not significant; * p < 0.05, ** p < 0.01, *** p < 0.001).

Journal: Cell reports

Article Title: B cell TET2 recruits OGT for nuclear TET2 and H2B O -GlcNAcylation to drive AID and BLIMP-1 expression and maturation of the antibody response

doi: 10.1016/j.celrep.2026.117370

Figure Lengend Snippet: (A-D) Tcrβ −/− Tcrδ −/− mice were injected i.p. with nil (PBS, n = 7) or vitamin C (Vit C, 80 mg per mice, n = 7) on days 1, 1, 3, and 5. Nil-treated and vitamin C-treated Tcrβ −/− Tcrδ −/− mice were immunized i.p. with NP 0.4 -LPS on day 0, boosted on days 14 and 23, and euthanized on day 44. (A) Top left, schematic of nil or vitamin C administration and NP 0.4 -LPS immunization. Top center, sera were collected on days 7, 14, 23, 33, and 44 and analyzed for NP 4 - or LPS-specific IgM, IgG3, and IgG2b, as measured by ELISAs (titers expressed as RUs). Truncated violin plots depict NP 4 - or LPS-specific IgM, IgG3, and IgG2b titers through day 44. Top right, floating bar plots depict NP 4 - or LPS-specific antibody titers at day 33. Bottom right, GC GL7 + CD95 + B cells, class-switched GC GL7 + CD95 + IgG3 + and GL7 + CD95 + IgG2b + B cells among pre-gated CD19 + cells in MLNs (left), NP 5 -specific IgG3 + and IgG2b + B cells among pre-gated CD19 + cells in spleen (center), and CD19 + CD138 + plasmablasts among mononuclear cells in MLNs (right). (B) NP 4 -specific IgM, IgG3, and IgG2b ASCs in spleen and BM, as analyzed and enumerated by specific ELISPOTs. (C) Somatic point-mutations in IgG3 + B cell V1-72DJ H -Cγ3 and IgG2b + B cell V1-72DJ H -Cγ2b transcripts. Left, pie charts depict proportions of V1-72DJ H -Cγ3 and V1-72DJ H -Cγ2b transcripts carrying different numbers of point-mutations; the overall mutation frequency is listed below each pie chart (V1-72DJ H -Cγ3: nil, 0.65 × 10 −2 change/base vs. vitamin C, 2.19 × 10 −2 change/base; V1-72DJ H -Cγ2b: nil, 0.71 × 10 −2 change/base vs. vitamin C, 1.35 × 10 −2 change/base). Center, histograms depict means of total, S, and R V1-72 mutation frequencies (change/base) in FR1, CDR1, FR2, CDR2, and FR3 of V1-72DJ H -Cγ3 and V1-72DJ H -Cγ2b transcripts. Right, boxplots depict overall V1-72 point-mutation frequency in V1-72DJ H -Cγ3 and V1-72DJ H -Cγ2b transcripts. (D) Intracellular TET2, AID, and BLIMP-1 expression among pre-gated CD19 + cells in spleen. (E) Naïve IgM + IgD + B cells from C57BL/6 mice ( n = 3) were cultured for 72 h or 96 h upon stimulation with LPS plus IL-4 in the presence of nil or vitamin C (200 μM). Left, flow cytometry plots from one in vitro B cell microculture representative of 3 cell microcultures. CD19 + IgG1 + B cells and CD19 + CD138 + plasmablasts after 96 h culture. Top right, recruited TET2 and O -GlcNAcylation H2B-S112 levels in Aicda and Prdm1 promoter and enhancer regions in mouse B cells after 72 h culture. Bottom right, cell methylated and hydroxymethylated DNA in Aicda and Prdm1 promoter and enhancer regions after 72 h culture. Statistical significance (A, C, and E) was assessed using two-sided Student’s unpaired t test (ns, not significant; * p < 0.05, ** p < 0.01, *** p < 0.001).

Article Snippet: anti-mo/hu-TET2 Ab , ABclonal , Cat. # A20365.

Techniques: Injection, Mutagenesis, Expressing, Cell Culture, Flow Cytometry, In Vitro, Methylation

Review

tet2 (New England Biolabs)

Structured Review

Images

Related Articles

other:

DNA Extraction:

Gentle:

Purification:

Similar Products

Image Search Results